header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-171204-1
Morpholino Name: MO5-mecp2
Target: mecp2 (1)
Sequence:
5' - CTCACCTCTGCTGACAACAAAATAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-mecp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-mecp2
Expressed Gene Anatomy Figures
robo2 Fig. 5 with image from Leong et al., 2015
sema3fa Fig. 5 with image from Leong et al., 2015
sema5ba Fig. 5 with image from Leong et al., 2015
PHENOTYPE
Phenotype resulting from MO5-mecp2
Phenotype of all Fish created by or utilizing MO5-mecp2
Phenotype Fish Conditions Figures
trigeminal ganglion axon decreased length, abnormal mecp2fh232/fh232 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal mecp2fh232/fh232 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal AB + MO4-tp53 + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
whole organism robo2 expression decreased amount, abnormal AB + MO5-mecp2 standard conditions Fig. 5 with image from Leong et al., 2015
trigeminal ganglion axon arborization disrupted, abnormal AB + MO5-mecp2 standard conditions Fig. 1 with imageFig. 2 with image from Leong et al., 2015
trigeminal ganglion axon decreased length, abnormal AB + MO5-mecp2 standard conditions Fig. 2 with image from Leong et al., 2015
trigeminal ganglion axon branchiness, abnormal AB + MO5-mecp2 standard conditions Fig. 1 with imageFig. 2 with image from Leong et al., 2015
whole organism sema3fa expression decreased amount, abnormal AB + MO5-mecp2 standard conditions Fig. 5 with image from Leong et al., 2015
whole organism sema5ba expression decreased amount, abnormal AB + MO5-mecp2 standard conditions Fig. 5 with image from Leong et al., 2015
apoptotic process increased occurrence, abnormal AB + MO5-mecp2 standard conditions Fig. 3 with image from Leong et al., 2015
sensory perception of touch disrupted, abnormal AB + MO5-mecp2 standard conditions Fig. 7 with image from Leong et al., 2015
OTHER MO5-mecp2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)