header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-171117-9
Morpholino Name: MO2-en1b
Target: en1b (1)
Sequence:
5' - TTAAGAAACTAGCGCCTTACCAGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-en1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-en1b No data available
PHENOTYPE
Phenotype resulting from MO2-en1b
No data available

Phenotype of all Fish created by or utilizing MO2-en1b
OTHER MO2-en1b MORPHOLINO PAGES No links to external sites
CITATIONS (1)