ZFIN ID: ZDB-MRPHLNO-171117-9
Morpholino Name: MO2-en1b
Target: en1b (1)
Sequence:
5' - TTAAGAAACTAGCGCCTTACCAGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-en1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-en1b No data available
PHENOTYPE
Phenotype resulting from MO2-en1b
No data available

Phenotype of all Fish created by or utilizing MO2-en1b
Phenotype Fish Conditions Figures
axonogenesis disrupted, abnormal i233Tg + MO1-en1a + MO1-en1b + MO2-en1a + MO2-en1b + MO2-en2a + MO3-en2a standard conditions Fig. 11 with imageFig. SMovie5 from Ahmed et al., 2017
primary motor neuron axon truncated, abnormal i233Tg + MO1-en1a + MO1-en1b + MO2-en1a + MO2-en1b + MO2-en2a + MO3-en2a standard conditions Fig. 11 with image from Ahmed et al., 2017
primary motor neuron axon truncated, abnormal i233Tg + MO2-en1a + MO2-en1b + MO3-en2a standard conditions Fig. 11 with image from Ahmed et al., 2017
axonogenesis disrupted, abnormal i233Tg + MO2-en1a + MO2-en1b + MO3-en2a standard conditions Fig. 11 with image from Ahmed et al., 2017
OTHER MO2-en1b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)