header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-171107-1
Morpholino Name: MO1-nup210
Target: nup210 (1)
Sequence:
5' - CACGAGCAGACCGACCTTCTCCATA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nup210 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nup210
Expressed Gene Anatomy Figures
myf5 Fig. 2 with image from Raices et al., 2017
myod1 Fig. 2 with image from Raices et al., 2017
pax3a Fig. 2 with image from Raices et al., 2017
PHENOTYPE
Phenotype resulting from MO1-nup210
Phenotype of all Fish created by or utilizing MO1-nup210
Phenotype Fish Conditions Figures
muscle cell skeletal muscle myofibril structure, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 3 with image from Raices et al., 2017
muscle cell undulate, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
somite U-shaped, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 4 with imageFig. 5 with image from Raices et al., 2017
muscle cell detached from myoseptum, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 2 with image from Raices et al., 2017
heart edematous, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 control Fig. 2 with image from Raices et al., 2017
somite decreased width, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
muscle disorganized, abnormal TL + MO1-nup210 control Fig. 3 with imageFig. 4 with imageFig. 5 with image from Raices et al., 2017
whole organism decreased length, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
somite decreased length, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
myotome apoptotic process increased occurrence, abnormal TL + MO1-nup210 control Fig. 3 with image from Raices et al., 2017
caudal fin curved, abnormal TL + MO1-nup210 control Fig. 1 with image from Raices et al., 2017
skeletal muscle fiber development decreased process quality, abnormal TL + MO1-nup210 chemical treatment by environment: Cyclopamine Fig. 2 with image from Raices et al., 2017
muscle cell structure, abnormal TL + MO1-nup210 control Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 5 with image from Raices et al., 2017
muscle cell structure, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
somite U-shaped, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
muscle disorganized, exacerbated TL + MO1-nup210 + MO1-pom121 control Fig. 5 with image from Raices et al., 2017
somite U-shaped, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
muscle disorganized, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
muscle cell structure, exacerbated TL + MO1-nup210 + MO1-trip6 control Fig. 4 with image from Raices et al., 2017
OTHER MO1-nup210 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)