header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-171018-1
Morpholino Name: MO2-ccl25b
Target: ccl25b (1)
Sequence:
5' - AAACCTTAAACCTTACCTTGTGCGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ccl25b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ccl25b
Expressed Gene Anatomy Figures
ccnd1 Fig. 6 with image from Xue et al., 2017
cdc5l Fig. 6 with image from Xue et al., 2017
cdk1 Fig. 6 with image from Xue et al., 2017
cdk2 Fig. 6 with image from Xue et al., 2017
cdkn1a Fig. 6 with image from Xue et al., 2017
mnd1 Fig. 6 with image from Xue et al., 2017
myb Fig. 6 with image from Xue et al., 2017
ncapd2 Fig. 6 with image from Xue et al., 2017
nusap1 Fig. 6 with image from Xue et al., 2017
zw10 Fig. 6 with image from Xue et al., 2017
PHENOTYPE
Phenotype resulting from MO2-ccl25b
Phenotype of all Fish created by or utilizing MO2-ccl25b
Genome Resources:
CITATIONS (1)