ZFIN ID: ZDB-MRPHLNO-171016-2
Morpholino Name: MO4-mecp2
Target: mecp2 (1)
Sequence:
5' - ACTTCCTGTAACTTGTACTAACTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mecp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mecp2 No data available
PHENOTYPE
Phenotype resulting from MO4-mecp2
Phenotype Figures
CaP motoneuron axon decreased branchiness, abnormal Fig. 2 from Nozawa et al., 2017
CaP motoneuron axon morphology, abnormal Fig. 2 from Nozawa et al., 2017
CaP motoneuron axonogenesis disrupted, abnormal Fig. 2 from Nozawa et al., 2017
motor neuron axon guidance disrupted, abnormal Fig. 2Fig. 4 from Nozawa et al., 2017
secondary motor neuron axon decreased branchiness, abnormal Fig. 4 from Nozawa et al., 2017
secondary motor neuron axon morphology, abnormal Fig. 4 from Nozawa et al., 2017
swimming behavior process quality, abnormal Fig. 4 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal Fig. 3 from Nozawa et al., 2017

Phenotype of all Fish created by or utilizing MO4-mecp2
Phenotype Fish Conditions Figures
secondary motor neuron axon morphology, abnormal WT + MO4-mecp2 standard conditions Fig. 4 from Nozawa et al., 2017
CaP motoneuron axon morphology, abnormal WT + MO4-mecp2 standard conditions Fig. 2 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal WT + MO4-mecp2 standard conditions Fig. 3 from Nozawa et al., 2017
motor neuron axon guidance disrupted, abnormal WT + MO4-mecp2 standard conditions Fig. 2Fig. 4 from Nozawa et al., 2017
CaP motoneuron axon decreased branchiness, abnormal WT + MO4-mecp2 standard conditions Fig. 2 from Nozawa et al., 2017
swimming behavior process quality, abnormal WT + MO4-mecp2 standard conditions Fig. 4 from Nozawa et al., 2017
secondary motor neuron axon decreased branchiness, abnormal WT + MO4-mecp2 standard conditions Fig. 4 from Nozawa et al., 2017
CaP motoneuron axonogenesis disrupted, abnormal WT + MO4-mecp2 standard conditions Fig. 2 from Nozawa et al., 2017
OTHER MO4-mecp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)