ZFIN ID: ZDB-MRPHLNO-171016-1
Morpholino Name: MO3-mecp2
Target: mecp2 (1)
Sequence:
5' - TCCGCTCTCTGCGGCGGCCATTTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-mecp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-mecp2
Expressed Gene Anatomy Figures
bdnf Fig. 5 from Nozawa et al., 2017
PHENOTYPE
Phenotype resulting from MO3-mecp2
Phenotype Figures
CaP motoneuron axon decreased branchiness, abnormal Fig. 2 from Nozawa et al., 2017
CaP motoneuron axon morphology, abnormal Fig. 2 from Nozawa et al., 2017
CaP motoneuron axonogenesis disrupted, abnormal Fig. 2 from Nozawa et al., 2017
motor neuron axon guidance disrupted, abnormal Fig. 2Fig. 4 from Nozawa et al., 2017
myotome neuromuscular junction ab-sv2 labeling increased distribution, abnormal Fig. 5 from Nozawa et al., 2017
myotome presynaptic density increased amount, abnormal Fig. 5 from Nozawa et al., 2017
neuromuscular junction development disrupted, abnormal Fig. 7 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal Fig. 1 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased length, abnormal Fig. 1 from Nozawa et al., 2017
secondary motor neuron axon decreased branchiness, abnormal Fig. 4 from Nozawa et al., 2017
secondary motor neuron axon morphology, abnormal Fig. 4 from Nozawa et al., 2017
swimming behavior process quality, abnormal Fig. 4 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal Fig. 3 from Nozawa et al., 2017
whole organism bdnf expression increased amount, abnormal Fig. 5 from Nozawa et al., 2017

Phenotype of all Fish created by or utilizing MO3-mecp2
Phenotype Fish Conditions Figures
Rohon-Beard neuron axon decreased length, abnormal WT + MO3-mecp2 standard conditions Fig. 1 from Nozawa et al., 2017
CaP motoneuron axon morphology, abnormal WT + MO3-mecp2 standard conditions Fig. 2 from Nozawa et al., 2017
myotome presynaptic density increased amount, abnormal WT + MO3-mecp2 standard conditions Fig. 5 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal WT + MO3-mecp2 standard conditions Fig. 3 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal WT + MO3-mecp2 standard conditions Fig. 1 from Nozawa et al., 2017
whole organism bdnf expression increased amount, abnormal WT + MO3-mecp2 standard conditions Fig. 5 from Nozawa et al., 2017
neuromuscular junction development disrupted, abnormal WT + MO3-mecp2 standard conditions Fig. 7 from Nozawa et al., 2017
myotome neuromuscular junction ab-sv2 labeling increased distribution, abnormal WT + MO3-mecp2 standard conditions Fig. 5 from Nozawa et al., 2017
secondary motor neuron axon decreased branchiness, abnormal WT + MO3-mecp2 standard conditions Fig. 4 from Nozawa et al., 2017
swimming behavior process quality, abnormal WT + MO3-mecp2 standard conditions Fig. 4 from Nozawa et al., 2017
secondary motor neuron axon morphology, abnormal WT + MO3-mecp2 standard conditions Fig. 4 from Nozawa et al., 2017
CaP motoneuron axonogenesis disrupted, abnormal WT + MO3-mecp2 standard conditions Fig. 2 from Nozawa et al., 2017
motor neuron axon guidance disrupted, abnormal WT + MO3-mecp2 standard conditions Fig. 2Fig. 4 from Nozawa et al., 2017
CaP motoneuron axon decreased branchiness, abnormal WT + MO3-mecp2 standard conditions Fig. 2 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased length, abnormal WT + MO1-bdnf + MO3-mecp2 standard conditions Fig. 8 from Nozawa et al., 2017
Rohon-Beard neuron axon decreased branchiness, abnormal WT + MO1-bdnf + MO3-mecp2 standard conditions Fig. 8 from Nozawa et al., 2017
thigmotaxis disrupted, abnormal WT + MO1-bdnf + MO3-mecp2 standard conditions Fig. 8 from Nozawa et al., 2017
OTHER MO3-mecp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)