ZFIN ID: ZDB-MRPHLNO-171011-1
Morpholino Name: MO1-nr2e1
Target: nr2e1 (1)
Previous Name: tlx MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTTGCTCATATTGAAGACCACGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nr2e1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nr2e1 No data available
PHENOTYPE
Phenotype resulting from MO1-nr2e1
No data available

Phenotype of all Fish created by or utilizing MO1-nr2e1
Phenotype Fish Conditions Figures
brain vegfaa expression amount, ameliorated WT + MO1-mir9 + MO1-nr2e1 + MO1-onecutl standard conditions Fig. 3 with image from Madelaine et al., 2017
OTHER MO1-nr2e1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)