header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170915-7
Morpholino Name: MO3-pycard
Target: pycard (1)
Previous Name: e2/i2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGTGATTCGCTTACTCACCATCAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pycard No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pycard No data available
PHENOTYPE
Phenotype resulting from MO3-pycard
No data available

Phenotype of all Fish created by or utilizing MO3-pycard
OTHER MO3-pycard MORPHOLINO PAGESNo links to external sites
CITATIONS (1)