Morpholino

MO2-tph2

ID

ZDB-MRPHLNO-170908-4

Name

MO2-tph2

Previous Names

None

Target

tph2 (1)

Sequence

5' - CAATGGGTTCAGCACTCACCATGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tph2

Expressed Gene	Anatomy	Figures
myb	hematopoietic multipotent progenitor cell	Fig. 2 from Kwan et al., 2016
runx1	ventral wall of dorsal aorta hematopoietic multipotent progenitor cell	Fig. 2, Fig. 7 from Kwan et al., 2016

Phenotype

Phenotype resulting from MO2-tph2

Phenotype	Fish	Figures
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	WT + MO2-tph2	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg + MO2-tph2	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal	WT + MO2-tph2	Fig. 2 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	WT + MO2-tph2	Fig. 2, Fig. 7 from Kwan et al., 2016

Phenotype of all Fish created by or utilizing MO2-tph2

Phenotype	Fish	Conditions	Figures
anatomical structure cortisol amount, ameliorated	WT + MO2-tph2	chemical treatment by environment: cobalt dichloride	Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	WT + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal	WT + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	WT + MO2-tph2	standard conditions	Fig. 2, Fig. 7 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	WT + MO2-tph2	chemical treatment by environment: cobalt dichloride	Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	WT + MO1-tph1a + MO1-tph1b + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal	WT + MO1-tph1a + MO1-tph1b + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal	WT + MO1-tph1a + MO1-tph1b + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	la2Tg + MO1-tph1a + MO1-tph1b + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell amount, ameliorated	pd27Tg; zf169Tg + MO2-tph2	chemical treatment by environment: serotonin	Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	pd27Tg; zf169Tg + MO2-tph2	control	Fig. 2, Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	pd27Tg; zf169Tg + MO2-tph2	chemical treatment by environment: cobalt dichloride	Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal	pd27Tg; zf169Tg + MO1-tph1a + MO1-tph1b + MO2-tph2	standard conditions	Fig. 2 from Kwan et al., 2016

Citations