ZFIN ID: ZDB-MRPHLNO-170831-1
Morpholino Name: MO1-kcna2a
Target: kcna2a (1)
Sequence:
5' - CCACAGTCATTATGCAGGAGGGTGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets the 5'UTR.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-kcna2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-kcna2a
Expressed Gene Anatomy Figures
kcna2a Fig. 4 from Srdanovic et al., 2017
PHENOTYPE
Phenotype resulting from MO1-kcna2a
Phenotype of all Fish created by or utilizing MO1-kcna2a
Genome Resources:
CITATIONS (1)