ZFIN ID: ZDB-MRPHLNO-170614-6
Morpholino Name: MO2-acp1
Target: acp1 (1)
Sequence:
5' - TATAGCATTTCTTACCCAAGCACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-acp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-acp1
Expressed Gene Anatomy Figures
slc12a3 Fig. S5 from Li et al., 2017
slc20a1a Fig. S5 from Li et al., 2017
PHENOTYPE
Phenotype resulting from MO2-acp1
Phenotype of all Fish created by or utilizing MO2-acp1
Genome Resources:
CITATIONS (1)