header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170614-5
Morpholino Name: MO1-acp1
Target: acp1 (1)
Sequence:
5' - TCCGCTGGAAGCCGCCATATTGGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-acp1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-acp1
Expressed Gene Anatomy Figures
pax2a Fig. 2 from Li et al., 2017
slc12a3 Fig. 2 from Li et al., 2017
slc20a1a Fig. 2 from Li et al., 2017
wt1a Fig. 2 from Li et al., 2017
PHENOTYPE
Phenotype resulting from MO1-acp1
Phenotype of all Fish created by or utilizing MO1-acp1
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule morphology, abnormal WT + MO1-acp1 standard conditions Fig. 3 from Li et al., 2017
pronephric proximal convoluted tubule increased length, abnormal WT + MO1-acp1 standard conditions Fig. 2 from Li et al., 2017
heart contraction increased rate, abnormal WT + MO1-acp1 standard conditions Fig. S5 from Li et al., 2017
pronephric proximal convoluted tubule decreased size, abnormal WT + MO1-acp1 standard conditions Fig. 3 from Li et al., 2017
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal WT + MO1-acp1 standard conditions Fig. 2 from Li et al., 2017
pronephros decreased functionality, abnormal WT + MO1-acp1 standard conditions Fig. 3 from Li et al., 2017
pronephric distal late tubule slc12a3 expression spatial pattern, abnormal WT + MO1-acp1 standard conditions Fig. 2 from Li et al., 2017
whole organism decreased life span, abnormal WT + MO1-acp1 standard conditions Fig. 3 from Li et al., 2017
pericardium edematous, abnormal WT + MO1-acp1 standard conditions Fig. 3 from Li et al., 2017
pronephric glomerulus pax2a expression spatial pattern, abnormal WT + MO1-acp1 standard conditions Fig. 2 from Li et al., 2017
whole organism decreased length, abnormal WT + MO1-acp1 standard conditions Fig. S5 from Li et al., 2017
pronephros pax2a expression spatial pattern, abnormal WT + MO1-acp1 standard conditions Fig. 2 from Li et al., 2017
pronephric distal late tubule decreased length, abnormal WT + MO1-acp1 standard conditions Fig. 2 from Li et al., 2017
Genome Resources:
CITATIONS (1)