ZFIN ID: ZDB-MRPHLNO-170531-2
Morpholino Name: MO1-ddrgk1
Target: ddrgk1 (1)
Sequence:
5' - CGATATAGAGAACCACATCCATGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ddrgk1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ddrgk1
Expressed Gene Anatomy Figures
col2a1a Fig. 4 from Egunsola et al., 2017
col2a1b Fig. 4 from Egunsola et al., 2017
sox9a Fig. 4 from Egunsola et al., 2017
sox9b Fig. 4 from Egunsola et al., 2017
PHENOTYPE
Phenotype resulting from MO1-ddrgk1
Phenotype of all Fish created by or utilizing MO1-ddrgk1
Genome Resources:
CITATIONS (1)