ZFIN ID: ZDB-MRPHLNO-170512-1
Morpholino Name: MO1-ece1
Target: ece1 (1)
Sequence:
5' - AAGTAGACATCTGAGGGAAATGTAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ece1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ece1 No data available
PHENOTYPE
Phenotype resulting from MO1-ece1
Phenotype of all Fish created by or utilizing MO1-ece1
Phenotype Fish Conditions Figures
ceratohyal cartilage decreased size, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratobranchial cartilage decreased amount, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage fused with hyosymplectic cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
basihyal cartilage decreased size, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 1 dlx5a expression decreased distribution, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
pharyngeal arch 2 dlx5a expression decreased distribution, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with Meckel's cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
ceratohyal cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
basihyal cartilage curved ventral, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
palatoquadrate cartilage hypoplastic, abnormal WT + MO1-ece1 + MO4-tp53 standard conditions Fig. 2 from Iklé et al., 2017
Genome Resources:
CITATIONS (1)