Morpholino

MO1-stat4

ID
ZDB-MRPHLNO-170508-2
Name
MO1-stat4
Previous Names
  • third-intron fourth exon splice acceptor (1)
Target
Sequence
5' - GTATTTCACCTGGGAGAATAGAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-stat4
Expressed Gene Anatomy Figures
atrip Fig. 7 with image from Meng et al., 2017
cdk2 Fig. 7 with image from Meng et al., 2017
cdkn1ca Fig. 7 with image from Meng et al., 2017
cdkn2a/b Fig. 7 with image from Meng et al., 2017
hdac3 Fig. 7 with image from Meng et al., 2017
stat1a Fig. 7 with image from Meng et al., 2017
stat1b Fig. 7 with image from Meng et al., 2017
tie1 Fig. 3 with image,  Fig. 6 with image from Meng et al., 2017
Phenotype
Phenotype resulting from MO1-stat4
Phenotype Fish Figures
aortic arch angioblastic mesenchymal cell tie1 expression decreased amount, abnormal AB/TU + MO1-stat4 Fig. 3 with image,  Fig. 6 with image from Meng et al., 2017
aortic arch 3 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 3 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 Fig. 4 with image from Meng et al., 2017
aortic arch 3 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 4 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 4 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 Fig. 4 with image from Meng et al., 2017
aortic arch 4 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 5 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 5 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 Fig. 4 with image from Meng et al., 2017
aortic arch 5 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 6 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
aortic arch 6 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 Fig. 4 with image from Meng et al., 2017
aortic arch 6 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 Fig. 3 with image from Meng et al., 2017
whole organism cdkn1ca expression decreased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
whole organism cdk2 expression decreased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
whole organism stat1b expression decreased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
whole organism stat1a expression increased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
whole organism atrip expression increased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
whole organism hdac3 expression increased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
whole organism cdkn2a/b expression increased amount, abnormal AB/TU + MO1-stat4 Fig. 7 with image from Meng et al., 2017
Phenotype of all Fish created by or utilizing MO1-stat4
Phenotype Fish Conditions Figures
aortic arch 4 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
whole organism hdac3 expression increased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
whole organism stat1a expression increased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression decreased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image,  Fig. 6 with image from Meng et al., 2017
aortic arch 4 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
aortic arch 6 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
whole organism stat1b expression decreased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
aortic arch 3 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
whole organism cdk2 expression decreased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
aortic arch 5 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
whole organism cdkn1ca expression decreased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
aortic arch 6 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
whole organism atrip expression increased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
aortic arch 5 vasculogenesis decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
aortic arch 3 angioblast cell differentiation decreased occurrence, abnormal AB/TU + MO1-stat4 standard conditions Fig. 3 with image from Meng et al., 2017
whole organism cdkn2a/b expression increased amount, abnormal AB/TU + MO1-stat4 standard conditions Fig. 7 with image from Meng et al., 2017
aortic arch 6 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 standard conditions Fig. 4 with image from Meng et al., 2017
aortic arch 4 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 standard conditions Fig. 4 with image from Meng et al., 2017
aortic arch 5 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 standard conditions Fig. 4 with image from Meng et al., 2017
aortic arch 3 cell population proliferation decreased occurrence, abnormal fb7Tg + MO1-stat4 standard conditions Fig. 4 with image from Meng et al., 2017
aortic arch angioblastic mesenchymal cell tie1 expression absent, abnormal AB/TU + MO1-stat4 + MO3-nkx2.5 standard conditions Fig. 6 with image from Meng et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.