header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170502-3
Morpholino Name: MO3-cyp19a1b
Target: cyp19a1b (1)
Sequence:
5' - TTACCACATGCTCCATCATCACCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cyp19a1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cyp19a1b No data available
PHENOTYPE
Phenotype resulting from MO3-cyp19a1b
Phenotype of all Fish created by or utilizing MO3-cyp19a1b
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal y1Tg + MO3-cyp19a1b control Fig. 2 from Alharthy et al., 2017
pericardium edematous, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
pericardium edematous, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
whole organism decreased length, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
yolk edematous, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
eye decreased size, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
swim bladder uninflated, abnormal y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
caudal fin morphology, abnormal y1Tg + MO3-cyp19a1b control Fig. 4 from Alharthy et al., 2017
yolk edematous, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
whole organism estradiol decreased amount, abnormal y1Tg + MO3-cyp19a1b control Fig. 5 from Alharthy et al., 2017
hatching occurrence, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 2 from Alharthy et al., 2017
hatching decreased occurrence, abnormal y1Tg + MO3-cyp19a1b control Fig. 2 from Alharthy et al., 2017
swim bladder uninflated, abnormal y1Tg + MO3-cyp19a1b control Fig. 3 from Alharthy et al., 2017
caudal fin morphology, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 4 from Alharthy et al., 2017
whole organism decreased length, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
whole organism decreased life span, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 2 from Alharthy et al., 2017
eye decreased size, ameliorated y1Tg + MO3-cyp19a1b chemical treatment by environment: 17beta-estradiol Fig. 3 from Alharthy et al., 2017
Genome Resources:
CITATIONS (1)