Morpholino

MO2-toe1

ID

ZDB-MRPHLNO-170427-1

Name

MO2-toe1

Previous Names

None

Target

toe1 (1)

Sequence

5' - GTGTTGTTTTTCTCACCGTATCAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-toe1

No data available

Phenotype

Phenotype resulting from MO2-toe1

Phenotype	Fish	Figures
brain morphology, abnormal	AB/TU + MO2-toe1	Fig. S5 from Lardelli et al., 2017
brain apoptotic process increased occurrence, abnormal	AB/TU + MO2-toe1	Fig. S5 from Lardelli et al., 2017
cerebellum apoptotic, abnormal	AB/TU + MO2-toe1	Fig. S5 from Lardelli et al., 2017
cerebellum morphology, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017
cerebellum neuron decreased amount, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017
cerebellum neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO2-toe1	Fig. 3 from Lardelli et al., 2017
eye decreased size, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017
head decreased size, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017
head morphology, abnormal	AB/TU + MO2-toe1	Fig. 3 from Lardelli et al., 2017
hindbrain apoptotic, abnormal	AB/TU + MO2-toe1	Fig. S5 from Lardelli et al., 2017
hindbrain morphology, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017
hindbrain neuron decreased amount, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017
hindbrain neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO2-toe1	Fig. 3 from Lardelli et al., 2017
post-vent region curved, abnormal	AB/TU + MO2-toe1	Fig. 3, Fig. S6 from Lardelli et al., 2017

Phenotype of all Fish created by or utilizing MO2-toe1

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
hindbrain apoptotic, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. S5 from Lardelli et al., 2017
hindbrain neuron decreased amount, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
head decreased size, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
hindbrain neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
brain apoptotic process increased occurrence, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. S5 from Lardelli et al., 2017
brain morphology, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. S5 from Lardelli et al., 2017
cerebellum apoptotic, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. S5 from Lardelli et al., 2017
hindbrain morphology, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
post-vent region curved, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
cerebellum morphology, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
cerebellum neuron decreased amount, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3, Fig. S6 from Lardelli et al., 2017
head morphology, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017
cerebellum neuron ab1-elavl labeling decreased amount, abnormal	AB/TU + MO2-toe1	standard conditions	Fig. 3 from Lardelli et al., 2017

Citations