header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170424-2
Morpholino Name: MO5-kdm1a
Target: kdm1a (1)
Sequence:
5' - CACAGATGACAGAGGCTTCTCCTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-kdm1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-kdm1a
Expressed Gene Anatomy Figures
hoxb1b Fig. 6 with image from Han et al., 2014
otx2b Fig. 6 with image from Han et al., 2014
sox2 Fig. 6 with image from Han et al., 2014
sox3 Fig. 6 with image from Han et al., 2014
PHENOTYPE
Phenotype resulting from MO5-kdm1a
Phenotype of all Fish created by or utilizing MO5-kdm1a
Genome Resources:
CITATIONS (1)