ZFIN ID: ZDB-MRPHLNO-170329-2
Morpholino Name: MO8-aldh1a2
Target: aldh1a2 (1)
Sequence:
5' - CTGCCGATGTGCGATTACAACTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO8-aldh1a2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO8-aldh1a2 No data available
PHENOTYPE
Phenotype resulting from MO8-aldh1a2
Phenotype of all Fish created by or utilizing MO8-aldh1a2
Genome Resources:
CITATIONS (1)