header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-161220-1
Morpholino Name: MO2-wnt9a
Target: wnt9a (1)
Sequence:
5' - GAAAGAATTGTCCTGCCTACCCGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-wnt9a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-wnt9a
Expressed Gene Anatomy Figures
gata2b Fig. 4 with image from Grainger et al., 2016
myb Fig. 3 with imageFig. 5 with image from Grainger et al., 2016
PHENOTYPE
Phenotype resulting from MO2-wnt9a
Phenotype of all Fish created by or utilizing MO2-wnt9a
OTHER MO2-wnt9a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)