ZFIN ID: ZDB-MRPHLNO-161101-9
Morpholino Name: MO3-tgfb2
Target: tgfb2 (1)
Sequence:
5' - AAAGGGACTTTGGATTTACCTGGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tgfb2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tgfb2
Expressed Gene Anatomy Figures
dlc Fig. 3 with image from Monteiro et al., 2016
dll4 Fig. 3 with image from Monteiro et al., 2016
kdrl Fig. 3 with image from Monteiro et al., 2016
runx1 Fig. 3 with image from Monteiro et al., 2016
PHENOTYPE
Phenotype resulting from MO3-tgfb2
No data available

Phenotype of all Fish created by or utilizing MO3-tgfb2
No data available
OTHER MO3-tgfb2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)