header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-161010-1
Morpholino Name: MO1-myo9aa
Target: myo9aa (1)
Sequence:
5' - CAGCAGGATGAAGTCGTACCTGATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-myo9aa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-myo9aa No data available
PHENOTYPE
Phenotype resulting from MO1-myo9aa
No data available

Phenotype of all Fish created by or utilizing MO1-myo9aa
Phenotype Fish Conditions Figures
whole organism movement quality, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
motor neuron axon truncated, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
thigmotaxis process quality, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
whole organism decreased life span, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
motor neuron neuromuscular junction morphology, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
swimming behavior process quality, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
whole organism dead, abnormal AB + MO1-myo9aa + MO1-myo9ab standard conditions Fig. 4 with image from O'Connor et al., 2018
larval locomotory behavior process quality, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. SVideo from O'Connor et al., 2016
motor neuron axon shortened, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 5 with image from O'Connor et al., 2016
post-vent region curved, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 4 with image from O'Connor et al., 2016
motor neuron axon increased branchiness, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 5 with image from O'Connor et al., 2016
swimming behavior process quality, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. SVideo10 from O'Connor et al., 2016
heart edematous, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. 4 with image from O'Connor et al., 2016
thigmotaxis disrupted, abnormal slc24a5b1/+ + MO1-myo9aa + MO1-myo9ab + MO4-tp53 standard conditions Fig. SVideo10 from O'Connor et al., 2016
Genome Resources:
CITATIONS (2)