header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160902-2
Morpholino Name: MO1-tgfbr3
Target: tgfbr3 (1)
Sequence:
5' - CCCCACACACTCTGAAGAATGACAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tgfbr3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tgfbr3
Expressed Gene Anatomy Figures
tgfbr3 Fig. 5 with image from Kamaid et al., 2015
PHENOTYPE
Phenotype resulting from MO1-tgfbr3
Phenotype of all Fish created by or utilizing MO1-tgfbr3
OTHER MO1-tgfbr3 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)