ZFIN ID: ZDB-MRPHLNO-160524-2
Morpholino Name: MO2-eepd1
Target: eepd1 (1)
Sequence:
5' - GCTAGAAGAACATAAACTCACGCTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-eepd1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-eepd1 No data available
PHENOTYPE
Phenotype resulting from MO2-eepd1
Phenotype Figures
caudal fin morphology, abnormal Fig. 2 with image from Chun et al., 2016
chordate embryonic development delayed, abnormal Fig. 2 with image from Chun et al., 2016
somite morphology, abnormal Fig. 2 with image from Chun et al., 2016
somite nucleus morphology, abnormal Fig. 4 with image from Chun et al., 2016
whole organism dead, abnormal Fig. 2 with image from Chun et al., 2016
whole organism morphology, abnormal Fig. 2 with image from Chun et al., 2016

Phenotype of all Fish created by or utilizing MO2-eepd1
Phenotype Fish Conditions Figures
chordate embryonic development delayed, abnormal AB/TU + MO2-eepd1 standard conditions Fig. 2 with image from Chun et al., 2016
somite morphology, abnormal AB/TU + MO2-eepd1 standard conditions Fig. 2 with image from Chun et al., 2016
somite nucleus ab7-h2afx labeling amount, ameliorated AB/TU + MO2-eepd1 chemical treatment by environment: hydroxyurea Fig. 3 with image from Chun et al., 2016
caudal fin morphology, abnormal AB/TU + MO2-eepd1 standard conditions Fig. 2 with image from Chun et al., 2016
whole organism dead, abnormal AB/TU + MO2-eepd1 standard conditions Fig. 2 with image from Chun et al., 2016
whole organism morphology, abnormal AB/TU + MO2-eepd1 standard conditions Fig. 2 with image from Chun et al., 2016
somite nucleus morphology, abnormal AB/TU + MO2-eepd1 standard conditions Fig. 4 with image from Chun et al., 2016
OTHER MO2-eepd1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)