header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160512-2
Morpholino Name: MO2-gpr65
Target: gpr65 (1)
Previous Name: Gpr65_SP MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAAATCGACAACTCACCATAAGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gpr65 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gpr65
Expressed Gene Anatomy Figures
myb Fig. 4 with image from Gao et al., 2016
runx1 Fig. 3 with image from Dobrzycki et al., 2018
Fig. 4 with image from Gao et al., 2016
PHENOTYPE
Phenotype resulting from MO2-gpr65
Phenotype of all Fish created by or utilizing MO2-gpr65
OTHER MO2-gpr65 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)