ZFIN ID: ZDB-MRPHLNO-160510-4
Morpholino Name: MO2-rcbtb1
Target: rcbtb1 (1)
Sequence:
5' - GTTAAAAAGCATTCCCTCACCTCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rcbtb1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rcbtb1 No data available
PHENOTYPE
Phenotype resulting from MO2-rcbtb1
Phenotype Figures
intersegmental vessel decreased thickness, abnormal text only from Wu et al., 2016

Phenotype of all Fish created by or utilizing MO2-rcbtb1
Phenotype Fish Conditions Figures
intersegmental vessel decreased thickness, abnormal y1Tg + MO2-rcbtb1 standard conditions text only from Wu et al., 2016
OTHER MO2-rcbtb1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)