ZFIN ID: ZDB-MRPHLNO-160510-3
Morpholino Name: MO1-rcbtb1
Target: rcbtb1 (1)
Sequence:
5' - GAGGCCACTTACTCACATCCACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rcbtb1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rcbtb1 No data available
PHENOTYPE
Phenotype resulting from MO1-rcbtb1
Phenotype Figures
intersegmental vessel decreased thickness, abnormal Fig. 3 from Wu et al., 2016
intersegmental vessel morphology, abnormal Fig. 3 from Wu et al., 2016
intersegmental vessel truncated, abnormal Fig. 3 from Wu et al., 2016
ocular blood vessel decreased area, abnormal Fig. 3 from Wu et al., 2016
ocular blood vessel morphology, abnormal Fig. 3 from Wu et al., 2016

Phenotype of all Fish created by or utilizing MO1-rcbtb1
Phenotype Fish Conditions Figures
intersegmental vessel truncated, abnormal y1Tg + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
intersegmental vessel decreased thickness, abnormal y1Tg + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
ocular blood vessel morphology, abnormal y1Tg + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
ocular blood vessel decreased area, abnormal y1Tg + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
intersegmental vessel morphology, abnormal y1Tg + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
ocular blood vessel morphology, abnormal y1Tg + MO1-ndp + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
ocular blood vessel decreased area, abnormal y1Tg + MO1-ndp + MO1-rcbtb1 standard conditions Fig. 3 from Wu et al., 2016
OTHER MO1-rcbtb1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)