ZFIN ID: ZDB-MRPHLNO-160408-2
Morpholino Name: MO4-fbxo32
Target: fbxo32 (1)
Sequence:
5' - AGTGCAGATTAAACACCGACCTCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO to splice donor site of exon 1.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-fbxo32 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-fbxo32 No data available
PHENOTYPE
Phenotype resulting from MO4-fbxo32
Phenotype Figures
heart morphology, abnormal Fig. 2 with image from Bühler et al., 2016
pericardium edematous, abnormal Fig. 2 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal Fig. 2 with image from Bühler et al., 2016

Phenotype of all Fish created by or utilizing MO4-fbxo32
Phenotype Fish Conditions Figures
heart morphology, abnormal WT + MO4-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
pericardium edematous, abnormal WT + MO4-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal WT + MO4-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
OTHER MO4-fbxo32 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)