header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160408-1
Morpholino Name: MO3-fbxo32
Target: fbxo32 (1)
Sequence:
5' - GTCTTGTCCAAGAAACGGCATTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-fbxo32 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-fbxo32
Expressed Gene Anatomy Figures
myh6 Fig. 4 with image from Bühler et al., 2016
myh7 Fig. 4 with image from Bühler et al., 2016
myod1 Fig. 3 with image from Bühler et al., 2016
myog Fig. 3 with image from Bühler et al., 2016
PHENOTYPE
Phenotype resulting from MO3-fbxo32
Phenotype of all Fish created by or utilizing MO3-fbxo32
Phenotype Fish Conditions Figures
skeletal muscle myofilament disorganized, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with imageFig. 6 with image from Bühler et al., 2016
cardiac muscle cell sarcomere decreased amount, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
thigmotaxis disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
heart morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
skeletal muscle vacuolated, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
heart contraction decreased rate, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
cardiac muscle cell mitochondrion morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
skeletal muscle morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
heart decreased functionality, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
skeletal muscle mitochondrial crista decreased amount, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
heart contraction decreased efficacy, abnormal WT + MO3-fbxo32 standard conditions Fig. 4 with image from Bühler et al., 2016
skeletal muscle mitochondrion morphology, abnormal WT + MO3-fbxo32 standard conditions Fig. 6 with image from Bühler et al., 2016
skeletal muscle refractivity, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with imageFig. S1 with image from Bühler et al., 2016
pericardium edematous, abnormal WT + MO3-fbxo32 standard conditions Fig. 2 with image from Bühler et al., 2016
autophagy disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 5 with image from Bühler et al., 2016
whole organism decreased mobility, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
locomotion involved in locomotory behavior disrupted, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
skeletal muscle disorganized, abnormal WT + MO3-fbxo32 standard conditions Fig. 3 with image from Bühler et al., 2016
OTHER MO3-fbxo32 MORPHOLINO PAGES No links to external sites
CITATIONS (1)