Morpholino

MO2-dnmt3bb.1

ID
ZDB-MRPHLNO-160406-1
Name
MO2-dnmt3bb.1
Previous Names
None
Target
Sequence
5' - CTCTCATCTGAAAGAATAGCAGAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dnmt3bb.1
Expressed Gene Anatomy Figures
atp2b1b Fig. 3 from Gore et al., 2016
cdh5 Fig. 3 from Gore et al., 2016
dll4 Fig. 3 from Gore et al., 2016
dnmt3bb.1 Fig. 3 from Gore et al., 2016
gna13b Fig. 3 from Gore et al., 2016
myb Fig. 2 with image,  Fig. 3 from Gore et al., 2016
notch1b Fig. 3 from Gore et al., 2016
pde7a Fig. 3 from Gore et al., 2016
ptena Fig. 3 from Gore et al., 2016
rag1 Fig. 2 with image from Gore et al., 2016
stat6 Fig. 3 from Gore et al., 2016
Phenotype
Phenotype resulting from MO2-dnmt3bb.1
Phenotype Fish Figures
blood cell DNA-methyltransferase activity decreased occurrence, abnormal EKW + MO2-dnmt3bb.1 Fig. 4 from Gore et al., 2016
whole organism rag1 expression decreased amount, abnormal EKW + MO2-dnmt3bb.1 Fig. 2 with image from Gore et al., 2016
whole organism myb expression decreased amount, abnormal EKW + MO2-dnmt3bb.1 Fig. 2 with image from Gore et al., 2016
Phenotype of all Fish created by or utilizing MO2-dnmt3bb.1
Phenotype Fish Conditions Figures
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group cell population proliferation decreased occurrence, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
blood cell DNA-methyltransferase activity decreased occurrence, abnormal EKW + MO2-dnmt3bb.1 standard conditions Fig. 4 from Gore et al., 2016
whole organism myb expression decreased amount, abnormal EKW + MO2-dnmt3bb.1 standard conditions Fig. 2 with image from Gore et al., 2016
whole organism rag1 expression decreased amount, abnormal EKW + MO2-dnmt3bb.1 standard conditions Fig. 2 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell apoptotic process increased occurrence, abnormal zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 2 S3 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell apoptotic, abnormal zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 2 S3 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell shape, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 8 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell atp2b1b expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell DNA-methyltransferase activity decreased occurrence, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell notch1b expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell gna13b expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell dll4 expression increased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell ptena expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell pde7a expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell cdh5 expression increased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell stat6 expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell dnmt3bb.1 expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell malformed, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 8 with image from Gore et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.