header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160406-1
Morpholino Name: MO2-dnmt3bb.1
Target: dnmt3bb.1 (1)
Sequence:
5' - CTCTCATCTGAAAGAATAGCAGAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dnmt3bb.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dnmt3bb.1
Expressed Gene Anatomy Figures
atp2b1b Fig. 3 from Gore et al., 2016
cdh5 Fig. 3 from Gore et al., 2016
dll4 Fig. 3 from Gore et al., 2016
dnmt3bb.1 Fig. 3 from Gore et al., 2016
gna13b Fig. 3 from Gore et al., 2016
myb Fig. 2 with imageFig. 3 from Gore et al., 2016
notch1b Fig. 3 from Gore et al., 2016
pde7a Fig. 3 from Gore et al., 2016
ptena Fig. 3 from Gore et al., 2016
rag1 Fig. 2 with image from Gore et al., 2016
stat6 Fig. 3 from Gore et al., 2016
PHENOTYPE
Phenotype resulting from MO2-dnmt3bb.1
Phenotype of all Fish created by or utilizing MO2-dnmt3bb.1
Phenotype Fish Conditions Figures
blood cell DNA methylation decreased occurrence, abnormal EKW + MO2-dnmt3bb.1 standard conditions Fig. 4 from Gore et al., 2016
whole organism rag1 expression decreased amount, abnormal EKW + MO2-dnmt3bb.1 standard conditions Fig. 2 with image from Gore et al., 2016
whole organism myb expression decreased amount, abnormal EKW + MO2-dnmt3bb.1 standard conditions Fig. 2 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell apoptotic, abnormal zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 2 S3 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell apoptotic process increased occurrence, abnormal zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 2 S3 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell stat6 expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell shape, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 8 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell atp2b1b expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell notch1b expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell DNA methylation decreased occurrence, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell dnmt3bb.1 expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell malformed, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 8 with image from Gore et al., 2016
hematopoietic multipotent progenitor cell gna13b expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell dll4 expression increased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell ptena expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell pde7a expression decreased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
hematopoietic multipotent progenitor cell cdh5 expression increased amount, abnormal y278Tg; zf169Tg + MO2-dnmt3bb.1 standard conditions Fig. 3 from Gore et al., 2016
OTHER MO2-dnmt3bb.1 MORPHOLINO PAGES No links to external sites
CITATIONS (1)