ZFIN ID: ZDB-MRPHLNO-160316-3
Morpholino Name: MO2-taf1
Target: taf1 (1)
Sequence:
5' - CATCATAGATATTCTCTCACCCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-taf1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-taf1 No data available
PHENOTYPE
Phenotype resulting from MO2-taf1
Phenotype Figures
optic tectum decreased area, abnormal Fig. 4 with image from O'Rawe et al., 2015

Phenotype of all Fish created by or utilizing MO2-taf1
Phenotype Fish Conditions Figures
optic tectum decreased area, abnormal WT + MO2-taf1 standard conditions Fig. 4 with image from O'Rawe et al., 2015
OTHER MO2-taf1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)