header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160303-1
Morpholino Name: MO1-serpinh1b
Target: serpinh1b (1)
Sequence:
5' - GCAATGAGGCTGGATACCCACATTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-serpinh1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-serpinh1b No data available
PHENOTYPE
Phenotype resulting from MO1-serpinh1b
Phenotype of all Fish created by or utilizing MO1-serpinh1b
Phenotype Fish Conditions Figures
lepidotrichium joint fin morphogenesis premature, abnormal WT + MO1-serpinh1b amputation: fin Fig. 7 with image from Bhadra et al., 2015
regenerating fin decreased length, abnormal WT + MO1-serpinh1b standard conditions Fig. 5 with image from Bhadra et al., 2015
regenerating fin msx1b expression decreased amount, abnormal WT + MO1-serpinh1b amputation: fin Fig. 8 from Bhadra et al., 2015
regenerating fin bone element decreased length, abnormal WT + MO1-serpinh1b amputation: fin Fig. 6 with image from Bhadra et al., 2015
fin regeneration decreased efficacy, abnormal WT + MO1-serpinh1b standard conditions Fig. 5 with image from Bhadra et al., 2015
regenerating fin cell population proliferation decreased occurrence, abnormal WT + MO1-serpinh1b standard conditions Fig. 5 with image from Bhadra et al., 2015
regenerating fin actinotrichium morphology, abnormal WT + MO1-serpinh1b amputation: fin Fig. 11 with image from Bhadra et al., 2015
regenerating fin actinotrichium decreased size, abnormal WT + MO1-serpinh1b amputation: fin Fig. 11 with image from Bhadra et al., 2015
lepidotrichium joint fin regeneration premature, abnormal WT + MO1-serpinh1b amputation: fin Fig. 7 with image from Bhadra et al., 2015
regenerating fin lepidotrichium segment decreased length, abnormal WT + MO1-serpinh1b amputation: fin Fig. 6 with image from Bhadra et al., 2015
fin regeneration decreased process quality, abnormal WT + MO1-serpinh1b standard conditions Fig. 5 with image from Bhadra et al., 2015
regenerating fin msx3 expression decreased amount, abnormal WT + MO1-serpinh1b amputation: fin Fig. 8 from Bhadra et al., 2015
Genome Resources:
CITATIONS (1)