Morpholino

MO2-fosab

ID
ZDB-MRPHLNO-160225-7
Name
MO2-fosab
Previous Names
None
Target
Sequence
5' - GCGTTAAGGCTGGTAAACATCATCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fosab
No data available
Phenotype
Phenotype resulting from MO2-fosab
No data available
Phenotype of all Fish created by or utilizing MO2-fosab
Citations