Morpholino

MO1-tapt1b

ID

ZDB-MRPHLNO-160106-8

Name

MO1-tapt1b

Previous Names

None

Target

tapt1b (1)

Sequence

5' - GAGATCTGCACACAGACATACAAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

intron 1 - exon 2 splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tapt1b

Expressed Gene	Anatomy	Figures
barx1	ceratohyal cartilage Meckel's cartilage (not) pharyngeal arch cranial neural crest cell	Fig. 8 from Symoens et al., 2015
sox9a	ceratohyal cartilage Meckel's cartilage (not) pharyngeal arch	Fig. 8 from Symoens et al., 2015

Phenotype

Phenotype resulting from MO1-tapt1b

Phenotype	Fish	Figures
ceratobranchial cartilage chondrocyte absent, abnormal	y1Tg + MO1-tapt1b	Fig. 7 from Symoens et al., 2015
cranial neural crest cell decreased amount, abnormal	y1Tg + MO1-tapt1b	Fig. 7 from Symoens et al., 2015
cranial neural crest cell disorganized, abnormal	y1Tg + MO1-tapt1b	Fig. 7 from Symoens et al., 2015

Phenotype of all Fish created by or utilizing MO1-tapt1b

Phenotype	Fish	Conditions	Figures
cranial neural crest cell disorganized, abnormal	y1Tg + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
ceratobranchial cartilage chondrocyte absent, abnormal	y1Tg + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
cranial neural crest cell decreased amount, abnormal	y1Tg + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
pectoral fin malformed, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
head decreased size, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
pharyngeal pouch closed, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. S14 from Symoens et al., 2015
ceratohyal cartilage morphology, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
pharyngeal arch cartilage poorly differentiated, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. S14 from Symoens et al., 2015
pharyngeal arch cranial neural crest cell barx1 expression absent, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 8 from Symoens et al., 2015
pharyngeal arch sox9a expression absent, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 8 from Symoens et al., 2015
splanchnocranium hypoplastic, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. S14 from Symoens et al., 2015
pericardium edematous, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
oral cavity decreased size, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. S14 from Symoens et al., 2015
ectomesenchyme morphology, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
oral epithelium epithelial cell morphology, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
ceratobranchial cartilage absent, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
splanchnocranium immature, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
dermatocranium ossification delayed, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 7 from Symoens et al., 2015
otic vesicle cilium decreased length, abnormal	tp53^zdf1/zdf1 + MO1-tapt1b	standard conditions	Fig. 6 from Symoens et al., 2015

Citations