ZFIN ID: ZDB-MRPHLNO-151229-1
Morpholino Name: MO4-rbfox1
Target: rbfox1 (1)
Sequence:
5' - AAGGGAGCTTGTTCTTACCATTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-rbfox1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-rbfox1 No data available
PHENOTYPE
Phenotype resulting from MO4-rbfox1
Phenotype Figures
brain edematous, abnormal Fig. 2 with image from Frese et al., 2015
cardiac ventricle decreased contractility, abnormal Fig. 2 with image from Frese et al., 2015
heart decreased functionality, abnormal Fig. 2 with image from Frese et al., 2015

Phenotype of all Fish created by or utilizing MO4-rbfox1
Phenotype Fish Conditions Figures
heart decreased functionality, abnormal WT + MO4-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
cardiac ventricle decreased contractility, abnormal WT + MO4-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
brain edematous, abnormal WT + MO4-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
OTHER MO4-rbfox1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)