header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-151109-12
Morpholino Name: MO2-tollip
Target: tollip (1)
Previous Name: UTR1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTATGATATGACGGACAGCGCCTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tollip No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tollip
Expressed Gene Anatomy Figures
fgf8a Fig. 8 with image from Toruń et al., 2015
myl7 Fig. 8 with image from Toruń et al., 2015
PHENOTYPE
Phenotype resulting from MO2-tollip
Phenotype of all Fish created by or utilizing MO2-tollip
OTHER MO2-tollip MORPHOLINO PAGESNo links to external sites
CITATIONS (1)