ZFIN ID: ZDB-MRPHLNO-150925-2
Morpholino Name: MO3-her2
Target: her2 (1)
Sequence:
5' - GTTGATGCGATCTCTGCGCATCTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-her2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-her2
Expressed Gene Anatomy Figures
gfap Fig. 3 with imageFig. 4 with image from Gao et al., 2015
map2 Fig. 3 with imageFig. 4 with image from Gao et al., 2015
nes Fig. 3 with imageFig. 4 with image from Gao et al., 2015
neurod1 Fig. 4 with image from Gao et al., 2015
PHENOTYPE
Phenotype resulting from MO3-her2
Phenotype Figures
brain has extra parts of type neuron, abnormal Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type astrocyte, abnormal Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type neuronal stem cell, abnormal Fig. 3 with image from Gao et al., 2015
brain neural precursor cell proliferation decreased occurrence, abnormal Fig. 3 with image from Gao et al., 2015
brain neuron differentiation increased occurrence, abnormal Fig. 3 with imageFig. 4 with image from Gao et al., 2015

Phenotype of all Fish created by or utilizing MO3-her2
Phenotype Fish Conditions Figures
brain has extra parts of type neuron, abnormal WT + MO3-her2 standard conditions Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type neuronal stem cell, abnormal WT + MO3-her2 standard conditions Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type astrocyte, abnormal WT + MO3-her2 standard conditions Fig. 3 with image from Gao et al., 2015
brain neuron differentiation increased occurrence, abnormal WT + MO3-her2 standard conditions Fig. 3 with imageFig. 4 with image from Gao et al., 2015
brain neural precursor cell proliferation decreased occurrence, abnormal WT + MO3-her2 standard conditions Fig. 3 with image from Gao et al., 2015
brain neuron differentiation increased occurrence, abnormal nl1Tg + MO3-her2 standard conditions Fig. 4 with image from Gao et al., 2015
OTHER MO3-her2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)