ZFIN ID: ZDB-MRPHLNO-150925-1
Morpholino Name: MO2-mecp2
Target: mecp2 (1)
Sequence:
5' - TCTGCGGCGGCCATTTTTATTTAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mecp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mecp2
Expressed Gene Anatomy Figures
dla Fig. 3 with image from Gao et al., 2015
dlb Fig. 3 with image from Gao et al., 2015
dlc Fig. 3 with image from Gao et al., 2015
elavl3 Fig. 2 with imageFig. 4 with imageFig. 6 with image from Gao et al., 2015
gfap Fig. 2 with imageFig. 3 with image from Gao et al., 2015
her2 Fig. 3 with imageFig. 5 with image from Gao et al., 2015
her4.1 Fig. 3 with image from Gao et al., 2015
id1 Fig. 5 with image from Gao et al., 2015
isl1 Fig. 2 with image from Gao et al., 2015
map2 Fig. 2 with imageFig. 3 with image from Gao et al., 2015
mecp2 Fig. 1 with image from Gao et al., 2015
nes Fig. 2 with imageFig. 3 with image from Gao et al., 2015
neurod1 Fig. 2 with imageFig. 4 with image from Gao et al., 2015
notch1a Fig. 3 with image from Gao et al., 2015
notch1b Fig. 3 with image from Gao et al., 2015
PHENOTYPE
Phenotype resulting from MO2-mecp2
Phenotype Figures
brain has extra parts of type astrocyte, abnormal Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain has extra parts of type neuronal stem cell, abnormal Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain has fewer parts of type neuron, abnormal Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain astrocyte differentiation increased occurrence, abnormal Fig. 2 with image from Gao et al., 2015
brain neural precursor cell proliferation increased occurrence, abnormal Fig. 2 with imageFig. 3 with imageFig. 6 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal Fig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 6 with image from Gao et al., 2015
brain neuronal stem cell proliferative, abnormal Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain Notch signaling pathway increased occurrence, abnormal Fig. 3 with image from Gao et al., 2015
facial ganglion has fewer parts of type motor neuron, abnormal Fig. 2 with image from Gao et al., 2015
trigeminal ganglion has fewer parts of type motor neuron, abnormal Fig. 2 with image from Gao et al., 2015
vagal ganglion has fewer parts of type motor neuron, abnormal Fig. 2 with image from Gao et al., 2015

Phenotype of all Fish created by or utilizing MO2-mecp2
Phenotype Fish Conditions Figures
brain Notch signaling pathway increased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 3 with image from Gao et al., 2015
brain has fewer parts of type neuron, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 6 with image from Gao et al., 2015
brain has extra parts of type neuronal stem cell, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain neuronal stem cell proliferative, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain astrocyte differentiation increased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain has extra parts of type astrocyte, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with imageFig. 3 with image from Gao et al., 2015
brain neural precursor cell proliferation increased occurrence, abnormal WT + MO2-mecp2 standard conditions Fig. 2 with imageFig. 3 with imageFig. 6 with image from Gao et al., 2015
brain has fewer parts of type neuron, abnormal nl1Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal nl1Tg + MO2-mecp2 standard conditions Fig. 2 with imageFig. 4 with imageFig. 6 with image from Gao et al., 2015
brain neuronal stem cell proliferative, abnormal pku322Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neural precursor cell proliferation increased occurrence, abnormal pku322Tg + MO2-mecp2 standard conditions Fig. 2 with imageFig. 6 with image from Gao et al., 2015
trigeminal ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
facial ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
brain neuron differentiation decreased occurrence, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with imageFig. 4 with imageFig. 6 with image from Gao et al., 2015
vagal ganglion has fewer parts of type motor neuron, abnormal rw0Tg + MO2-mecp2 standard conditions Fig. 2 with image from Gao et al., 2015
OTHER MO2-mecp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)