Morpholino

MO3-bptf

ID

ZDB-MRPHLNO-150923-3

Name

MO3-bptf

Previous Names

None

Target

bptf (1)

Sequence

5' - TCCGACGAAGCGTCCGTACCTGTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-bptf

Expressed Gene	Anatomy	Figures
bptf	whole organism	Fig. 1 from Ma et al., 2015

Phenotype

Phenotype resulting from MO3-bptf

Phenotype	Fish	Figures
whole organism bptf expression decreased amount, abnormal	TU + MO3-bptf	Fig. 1 from Ma et al., 2015

Phenotype of all Fish created by or utilizing MO3-bptf

Phenotype	Fish	Conditions	Figures
ATP-dependent histone chaperone activity process quality, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 9 from Ma et al., 2015
margin wnt8a expression decreased amount, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 5, Fig. 8 from Ma et al., 2015
forebrain neural keel increased size, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
neuroectoderm anterior region increased size, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
neuroectoderm anterior region sox2 expression increased distribution, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
neuroectoderm posterior region hoxb1b expression decreased distribution, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2, Fig. 6, Fig. 8 from Ma et al., 2015
margin wnt8a expression absent, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 5 from Ma et al., 2015
forebrain increased size, abnormal	TU + MO2-bptf + MO3-bptf	standard conditions	Fig. 1 from Ma et al., 2015
neuroectoderm anterior region otx2b expression increased distribution, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2, Fig. 6 from Ma et al., 2015
neuroectoderm anterior region sox3 expression increased distribution, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
neuroectoderm posterior region decreased size, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
whole organism bptf expression decreased amount, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 1 from Ma et al., 2015
neuroectoderm posterior region sox3 expression decreased distribution, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
spinal cord neural keel shha expression decreased distribution, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
spinal cord neural keel decreased size, abnormal	TU + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
trunk decreased size, abnormal	TU + MO2-bptf + MO3-bptf	standard conditions	Fig. 1 from Ma et al., 2015
whole organism bptf expression decreased amount, abnormal	TU + MO3-bptf	control	Fig. 1 from Ma et al., 2015
presumptive mesoderm ventro-lateral region GFP expression decreased amount, abnormal	w25Tg + MO2-bptf + MO3-bptf	control	Fig. 6 from Ma et al., 2015
mesoderm ventro-lateral region GFP expression decreased amount, abnormal	w25Tg + MO2-bptf + MO3-bptf	control	Fig. 6 from Ma et al., 2015
margin wnt8a expression decreased amount, abnormal	tdgf1^tz257/tz257 + MO2-bptf + MO3-bptf	control	Fig. 5 from Ma et al., 2015
neuroectoderm anterior region sox2 expression spatial pattern, abnormal	tdgf1^tz257/tz257 + MO2-bptf + MO3-bptf	control	Fig. 3 from Ma et al., 2015
neuroectoderm posterior region hoxb1b expression decreased distribution, abnormal	tdgf1^tz257/tz257 + MO2-bptf + MO3-bptf	control	Fig. 3, Fig. 6 from Ma et al., 2015
neuroectoderm anterior region otx2b expression increased distribution, abnormal	tdgf1^tz257/tz257 + MO2-bptf + MO3-bptf	control	Fig. 6 from Ma et al., 2015
neuroectoderm posterior region sox2 expression mislocalised, abnormal	tdgf1^tz257/tz257 + MO2-bptf + MO3-bptf	control	Fig. 3 from Ma et al., 2015
neuroectoderm anterior region otx2b expression spatial pattern, abnormal	tdgf1^tz257/tz257 + MO2-bptf + MO3-bptf	control	Fig. 3 from Ma et al., 2015
trunk decreased size, abnormal	tp53^zdf1/zdf1 + MO2-bptf + MO3-bptf	standard conditions	Fig. 1 from Ma et al., 2015
neuroectoderm posterior region hoxb1b expression decreased distribution, abnormal	tp53^zdf1/zdf1 + MO2-bptf + MO3-bptf	control	Fig. 2 from Ma et al., 2015
forebrain increased size, abnormal	tp53^zdf1/zdf1 + MO2-bptf + MO3-bptf	standard conditions	Fig. 1 from Ma et al., 2015

Citations