Morpholino

MO1-h2af1al

ID

ZDB-MRPHLNO-150916-2

Name

MO1-h2af1al

Previous Names

Target

Sequence

5' - GCTTCTTACCACGACCAGACATGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-h2af1al

Expressed Gene	Anatomy	Figures
h2af1al	whole organism	Fig. 7 from Yue et al., 2013

Phenotype

Phenotype resulting from MO1-h2af1al

Phenotype	Fish	Figures
embryonic morphogenesis arrested, abnormal	WT + MO1-h2af1al	Fig. 7 from Yue et al., 2013
hatching arrested, abnormal	WT + MO1-h2af1al	Fig. 7 from Yue et al., 2013
mitotic cell cycle asynchronous, abnormal	WT + MO1-h2af1al	Fig. 8 from Yue et al., 2013
regulation of mitotic cell cycle, embryonic disrupted, abnormal	WT + MO1-h2af1al	Fig. 8 from Yue et al., 2013
whole organism h2af1al expression decreased amount, abnormal	WT + MO1-h2af1al	Fig. 7 from Yue et al., 2013
whole organism monstrous, abnormal	WT + MO1-h2af1al	Fig. 7 from Yue et al., 2013
whole organism morphology, abnormal	WT + MO1-h2af1al + MO4-tp53	Fig. 7 from Yue et al., 2013

Phenotype of all Fish created by or utilizing MO1-h2af1al

Phenotype	Fish	Conditions	Figures
whole organism monstrous, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 7 from Yue et al., 2013
whole organism morphology, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 7 from Yue et al., 2013
regulation of mitotic cell cycle, embryonic disrupted, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 8 from Yue et al., 2013
hatching arrested, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 7 from Yue et al., 2013
embryonic morphogenesis arrested, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 7 from Yue et al., 2013
whole organism h2af1al expression decreased amount, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 7 from Yue et al., 2013
mitotic cell cycle asynchronous, abnormal	WT + MO1-h2af1al	standard conditions	Fig. 8 from Yue et al., 2013
whole organism morphology, abnormal	WT + MO1-h2af1al + MO4-tp53	standard conditions	Fig. 7 from Yue et al., 2013
whole organism monstrous, abnormal	WT + MO1-h2af1al + MO4-tp53	standard conditions	Fig. 7 from Yue et al., 2013
hatching arrested, abnormal	WT + MO1-h2af1al + MO4-tp53	standard conditions	Fig. 7 from Yue et al., 2013
embryonic morphogenesis arrested, abnormal	WT + MO1-h2af1al + MO4-tp53	standard conditions	Fig. 7 from Yue et al., 2013

Citations