header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150807-2
Morpholino Name: MO1-canx
Target: canx (1)
Previous Name: 􀀃􀀐􀀕􀀃-2 to +23 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CATAACCGCATCTTCAGCTCCATAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-canx No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-canx
Expressed Gene Anatomy Figures
hspa5 Fig. 9 with image from Hung et al., 2013
PHENOTYPE
Phenotype resulting from MO1-canx
Phenotype of all Fish created by or utilizing MO1-canx
OTHER MO1-canx MORPHOLINO PAGESNo links to external sites
CITATIONS (1)