header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150625-2
Morpholino Name: MO7-nr3c1
Target: nr3c1 (1)
Sequence:
5' - TTTAGGAGAAGCATCATTACGTCGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-nr3c1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-nr3c1
Expressed Gene Anatomy Figures
casp8 Fig. S1 from Chatzopoulou et al., 2015
mmp2 Fig. S1 from Chatzopoulou et al., 2015
parp3 Fig. S1 from Chatzopoulou et al., 2015
tp53 Fig. S1 from Chatzopoulou et al., 2015
PHENOTYPE
Phenotype resulting from MO7-nr3c1
Phenotype of all Fish created by or utilizing MO7-nr3c1
OTHER MO7-nr3c1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)