header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150618-8
Morpholino Name: MO2-cyp19a1b
Target: cyp19a1b (1)
Sequence:
5' - CGAGCCTGAGAGGACAACAAAGACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-cyp19a1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-cyp19a1b No data available
PHENOTYPE
Phenotype resulting from MO2-cyp19a1b
No data available

Phenotype of all Fish created by or utilizing MO2-cyp19a1b
No data available
Genome Resources:
CITATIONS (1)