ZFIN ID: ZDB-MRPHLNO-150618-4
Morpholino Name: MO1-pmelb
Target: pmelb (1)
Sequence:
5' - GTAGAGAATAGCTTCATTGTGTCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pmelb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pmelb No data available
PHENOTYPE
Phenotype resulting from MO1-pmelb
Phenotype Figures
melanosome assembly process quality, abnormal Fig. 5 with image from Burgoyne et al., 2015
melanosome localization process quality, abnormal Fig. 6 with image from Burgoyne et al., 2015
retinal pigmented epithelium melanosome morphology, abnormal Fig. 5 with image from Burgoyne et al., 2015

Phenotype of all Fish created by or utilizing MO1-pmelb
Phenotype Fish Conditions Figures
melanosome localization process quality, abnormal WT + MO1-pmelb standard conditions Fig. 6 with image from Burgoyne et al., 2015
retinal pigmented epithelium melanosome morphology, abnormal WT + MO1-pmelb standard conditions Fig. 5 with image from Burgoyne et al., 2015
melanosome assembly process quality, abnormal WT + MO1-pmelb standard conditions Fig. 5 with image from Burgoyne et al., 2015
retinal pigmented epithelium melanosome decreased amount, abnormal WT + MO1-pmelb + MO2-pmela standard conditions Fig. 5 with image from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal WT + MO1-pmelb + MO2-pmela standard conditions Fig. 6 with image from Burgoyne et al., 2015
melanosome assembly process quality, abnormal WT + MO1-pmelb + MO2-pmela standard conditions Fig. 5 with imageFig. 6 with image from Burgoyne et al., 2015
melanosome localization process quality, abnormal WT + MO1-pmelb + MO2-pmela standard conditions Fig. 6 with image from Burgoyne et al., 2015
retinal pigmented epithelium melanosome morphology, abnormal WT + MO1-pmelb + MO2-pmela standard conditions Fig. 5 with imageFig. 6 with image from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment structure, abnormal WT + MO1-pmelb + MO2-pmela standard conditions Fig. 6 with image from Burgoyne et al., 2015
OTHER MO1-pmelb MORPHOLINO PAGESNo links to external sites
CITATIONS (2)