header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150611-2
Morpholino Name: MO2-angptl2b
Target: angptl2b (1)
Sequence:
5' - GAGGTTTTTCTTGTGGCTCACCTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-angptl2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-angptl2b No data available
PHENOTYPE
Phenotype resulting from MO2-angptl2b
No data available

Phenotype of all Fish created by or utilizing MO2-angptl2b
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with imageFig. 4 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell absent, abnormal WT + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with imageFig. 4 with image from Lin et al., 2015
intersegmental vessel kdrl expression decreased amount, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
dorsal aorta flt4 expression mislocalised, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
dorsal aorta flt4 expression increased amount, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
dorsal aorta efnb2a expression absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal WT + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
intersegmental vessel EGFP expression decreased amount, abnormal um14Tg + MO1-angptl1a + MO2-angptl2b control Fig. 2 with image from Lin et al., 2015
dorsal aorta EGFP expression decreased amount, abnormal um14Tg + MO1-angptl1a + MO2-angptl2b control Fig. 2 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell amount, ameliorated kca3Tg; kca4Tg + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression amount, ameliorated kca3Tg; kca4Tg + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
Genome Resources:
CITATIONS (1)