header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150611-2
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.
Morpholino Name: MO2-angptl2b
Target: angptl2b (1)
Sequence:
5' - GAGGTTTTTCTTGTGGCTCACCTTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-angptl2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-angptl2b No data available
PHENOTYPE
Phenotype resulting from MO2-angptl2b
No data available

Phenotype of all Fish created by or utilizing MO2-angptl2b
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image,  Fig. 4 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell absent, abnormal WT + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image,  Fig. 4 with image from Lin et al., 2015
intersegmental vessel kdrl expression decreased amount, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
dorsal aorta flt4 expression mislocalised, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
dorsal aorta flt4 expression increased amount, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
dorsal aorta efnb2a expression absent, abnormal WT + MO1-angptl1a + MO2-angptl2b control Fig. 1 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal WT + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
intersegmental vessel EGFP expression decreased amount, abnormal um14Tg + MO1-angptl1a + MO2-angptl2b control Fig. 2 with image from Lin et al., 2015
dorsal aorta EGFP expression decreased amount, abnormal um14Tg + MO1-angptl1a + MO2-angptl2b control Fig. 2 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell amount, ameliorated kca3Tg; kca4Tg + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression amount, ameliorated kca3Tg; kca4Tg + MO1-angptl1a + MO2-angptl2b heat shock Fig. 2 with image from Lin et al., 2015
Genome Resources:
CITATIONS (1)