ZFIN ID: ZDB-MRPHLNO-150515-1
Morpholino Name: MO2-sox4a
Target: sox4a (1)
Sequence:
5' - GCGCTAAGAGTCTTTCTTCTTCACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sox4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sox4a No data available
PHENOTYPE
Phenotype resulting from MO2-sox4a
No data available

Phenotype of all Fish created by or utilizing MO2-sox4a
Phenotype Fish Conditions Figures
optic fissure closure incomplete, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 9 with image from Wen et al., 2015
retina cell population proliferation decreased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 9 with image from Wen et al., 2015
retinal ganglion cell layer cell population proliferation increased occurrence, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
retina protruding into brain, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
retinal pigmented epithelium broken, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
smoothened signaling pathway increased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 6 with image from Wen et al., 2015
retina apoptotic process increased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
optic fissure morphology, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
smoothened signaling pathway increased process quality, abnormal umz24Tg + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 5 with image from Wen et al., 2015
OTHER MO2-sox4a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)