Morpholino

MO3-mecom

ID

ZDB-MRPHLNO-150410-1

Name

MO3-mecom

Previous Names

None

Target

mecom (1)

Sequence

5' - CTGAGTGACTTACATATGAAGGGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-mecom

Expressed Gene	Anatomy	Figures
emx1	pronephric duct	Fig. 6 from Morales et al., 2018
slc12a3	pronephric distal late tubule	Fig. 6, Fig. 8 from Morales et al., 2018
tbx2a	pronephric duct	Fig. 8 from Morales et al., 2018
tbx2b	pronephric duct	Fig. 8 from Morales et al., 2018

Phenotype

Phenotype resulting from MO3-mecom

Phenotype	Fish	Figures
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	WT + MO3-mecom	Fig. 6, Fig. 8 from Morales et al., 2018
pronephric distal late tubule decreased length, abnormal	WT + MO3-mecom	Fig. 6, Fig. 8 from Morales et al., 2018
pronephric duct emx1 expression decreased distribution, abnormal	WT + MO3-mecom	Fig. 6 from Morales et al., 2018
pronephric duct tbx2a expression decreased distribution, abnormal	WT + MO3-mecom	Fig. 8 from Morales et al., 2018
pronephric duct tbx2b expression decreased distribution, abnormal	WT + MO3-mecom	Fig. 8 from Morales et al., 2018

Phenotype of all Fish created by or utilizing MO3-mecom

Phenotype	Fish	Conditions	Figures
pronephric distal late tubule decreased length, abnormal	WT + MO3-mecom	standard conditions	Fig. 6, Fig. 8 from Morales et al., 2018
pronephric duct tbx2a expression decreased distribution, abnormal	WT + MO3-mecom	standard conditions	Fig. 8 from Morales et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal	WT + MO3-mecom	standard conditions	Fig. 6, Fig. 8 from Morales et al., 2018
pronephric duct tbx2b expression decreased distribution, abnormal	WT + MO3-mecom	standard conditions	Fig. 8 from Morales et al., 2018
pronephric duct emx1 expression decreased distribution, abnormal	WT + MO3-mecom	standard conditions	Fig. 6 from Morales et al., 2018
pronephric distal late tubule decreased size, abnormal	WT + MO3-mecom + MO4-mecom	chemical treatment: all-trans-retinoic acid	Fig. 5 from Li et al., 2014
pericardium edematous, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 2 from Li et al., 2014
pronephros multi-ciliated epithelial cell aggregated, abnormal	WT + MO3-mecom + MO4-mecom	chemical treatment: DAPT	Fig. 7 from Li et al., 2014
pronephros multi-ciliated epithelial cell increased amount, abnormal	WT + MO3-mecom + MO4-mecom	chemical treatment: DAPT	Fig. 7 from Li et al., 2014
pronephric distal late tubule decreased size, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 4 , Fig. 5 from Li et al., 2014
pronephric proximal straight tubule distended, abnormal	WT + MO3-mecom + MO4-mecom	chemical treatment: all-trans-retinoic acid	Fig. 5 from Li et al., 2014
pronephros multi-ciliated epithelial cell aggregated, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 7 from Li et al., 2014
pronephros multi-ciliated epithelial cell increased amount, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 7 from Li et al., 2014
whole organism anterior-posterior axis curved, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 2 from Li et al., 2014
blood accumulation heart, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. S4 from Li et al., 2014
renal system process decreased process quality, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 2 from Li et al., 2014
pronephric proximal straight tubule distended, abnormal	WT + MO3-mecom + MO4-mecom	standard conditions	Fig. 3 , Fig. 5 from Li et al., 2014

Citations