ZFIN ID: ZDB-MRPHLNO-150402-8
Morpholino Name: MO2-gpc4
Target: gpc4 (1)
Sequence:
5' - AACACAACGATCATCTTCATCGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-gpc4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-gpc4
Expressed Gene Anatomy Figures
dlx3b Fig. 7 with image from Shao et al., 2009
myod1 Fig. 7 with image from Shao et al., 2009
PHENOTYPE
Phenotype resulting from MO2-gpc4
Phenotype of all Fish created by or utilizing MO2-gpc4
Genome Resources:
CITATIONS (1)