header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150324-6
Morpholino Name: MO1-snx17
Target: snx17 (1)
Sequence:
5' - AGACCAACACTTTCTCACCAGCTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-snx17 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-snx17
Expressed Gene Anatomy Figures
elavl3 Fig. 1 with image from Yin et al., 2012
fabp1a Fig. 1 with image from Yin et al., 2012
ins Fig. 1 with image from Yin et al., 2012
prss1 Fig. 1 with image from Yin et al., 2012
PHENOTYPE
Phenotype resulting from MO1-snx17
No data available

Phenotype of all Fish created by or utilizing MO1-snx17
No data available
OTHER MO1-snx17 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)