header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150324-5
Morpholino Name: MO7-sox2
Target: sox2 (1)
Sequence:
5' - GCTCGGTTTCCATCATGTTATACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino differs by only one nucleotide from MO1-sox2 and MO5-sox2,sox3.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-sox2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-sox2 No data available
PHENOTYPE
Phenotype resulting from MO7-sox2
No data available

Phenotype of all Fish created by or utilizing MO7-sox2
No data available
Genome Resources:
CITATIONS (1)